Sequence investigation plan 9-3-13

2015-01-13

++ Sequence investigation plan 9-3-13

Order primers within the Hnrnpul1 transcript in order to see more of the sequence.

Order primers within Hnrnpul1 in order to determine the full sequence of the fragment (see 8-26-13). I'll send template "1p2 8-26-13" for sequencing.



HNRR (for Hnrnpul1 reverse)


CTATGGAGGCTACTCGGGC


19 bp


55.3 Tm





HNRR2 (for Hnrnpul1 2 reverse)


GGAGCTATGGCCCCTACAATC


21 bp


56.2 Tm








HNRF (for Hnrnpul1 forward)


CAAACGGTCTCATTTTCCGTCTC


23 bp


55.2 Tm





HNRF2 (for Hnrnpul1 2 forward)


GGCAAAGTGAAGTTGGCTTTC


21 bp


56.2 Tm

Hnrnpul1 assembled fragment in this file
"F:\kurt\storage\CIM Research Folder\DR\2013\9-3-13\sequence results 9-3-13\sequence results 9-3-13.SPF"

-Order pJET sequencing primers which are farther away from the sequencing site
JETF2 (for pJET sequencing primer forward 2)
CTTACTACTCGATGAGTTTTCGG
23 bp
53.4 Tm

JETR2 (for pJET sequencing primer reverse 2)
CGATTGCCAAGAAAACCCACGC
22 bp
56.6 Tm

see CloneJet PCR Cloning Kit

"F:\kurt\storage\CIM Research Folder\DR\2013\8-10-13\azim58 wikispaces download as of 8-10-13\CloneJet PCR Cloning Kit.txt"

Order primers to perform a nested pcr for transcripts which I think may have a different number of bands with tumor compared to normal.

Need to find where I recorded transcripts with different bands between tumor and normal. I guess last presentation would be a good place to start.
referred to Summary of Transcript PCRS slide in this presentation
"F:\kurt\storage\CIM Research Folder\kwhittem\Presentations\2013\General Meeting Presentation 8-14-13\General Meeting Presentation 8-14-13.pptx"

Need to order nested pcr primers for transcripts which were a frameshift in the library and have extra unique bands in the tumor or normal. The following transcripts meet that criteria

Eif1a (with the Tr primers (Tr is for truncated))
Rnf130 (both non-Tr and Tr (I'll order the nested primers for the Tr only))
Hiatl1 (with non-Tr only)

I could also look at these other 2 since they have extra unique bands with the tumor

Mxd1 (with Tr only)
Cco1 (with non-Tr only)

Need to find where I have the original primers.
They are found here:
"F:\kurt\storage\CIM Research Folder\DR\2013\8-10-13\azim58 wikispaces download as of 8-10-13\Tumor Validation primers 1-28-13.html"

Now I can design primers for these 5 transcripts.
Eif1a
Rnf130
Hiatl1
Mxd1
Cco1

Nested PCRs I plan to do



-FEATr+REATr (2667 bp) then FEATr2+REATr2 (2616 bp)


-FR130Tr+RR130Tr (1298 bp) -> FR130Tr2+RR130Tr2 (1223 bp) 


-FH1+RH1 (3375 bp) -> FH1_2+RH1_2 (3282 bp)


-FM1Tr+RM1Tr (4372 bp) -> FM1Tr2+RM1Tr2 (4278)


-Fco1+Rco1WT (1616 bp) -> Fco1_2+Rco1_2 (1494 bp)

see
primers related to sequencing tumor library products 9-6-13
nested pcr with tumor transcripts 9-10-13

When I receive these primers, I can immediately sequence 1p2 8-26-13 with the
HNRR
HNRR2
HNRF
HNRF2
JETF2
JETR2

I can also then perform the nested pcrs as described above, extract these fragments, clone them into pJET, and then send them for sequencing.

cDNA Sequence Analysis with source info 2 11-25-12
^I came across this file, and I may want to include some of these sequence alignments into my dissertation. Maybe in the appendix.