Sequencing primers for the In-Fusion SMARTer Directional cDNA Library Construction Kit
2015-01-13azim58 - Sequencing primers for the In-Fusion SMARTer Directional cDNA
Library Construction Kit
Sequencing primers that came with kit
Forward Screening Primer (closest to promoter; 50 bp from end of forward
screening primer to beginning of in-fusion site)
TCACACAGGAAACAGCTATGA
Reverse Screening Primer (furthest from promoter; 106 bp from end of
reverse screening primer to beginning of in-fusion site)
CCTCTTCGCTATTACGCCAGC
see alignment of vector with sequencing primers
"C:\kurt\storage\CIM Research
Folder\DR\2013\2-11-13\pSMART2IFD_sequencing\pSMART2IFD_with_sequencing_pri
mers.SPF"
I would prefer sequencing primers that are 200 bp upstream of the site to
be sequenced. Here will be my new custom primers.
reverse sequencing primer (SDSR for pSMARTIFD Sequencing reverse)
ACCGCACAGATGCGTAAGG
19 bp 53.1 Tm
forward sequencing primer (SDSF for pSMARTIFD sequencing primer forward)
AATGCAGCTGGCACGACAGG
20 bp 55.8 Tm
The SDSF and SDSR primers are located at 4 C Kurt 11-16-12 (2.5 uM and 10
uM) (the 100 uM stock is located -20 C freezer Q Reese Probe 80)
Instances of new custom sequencing primers for the in-fusion SMARTer
Directional cDNA Library Construction Kit
2-11-13
Primer Order Form
"C:\kurt\storage\CIM Research
Folder\DR\2013\2-11-13\pSMART2IFD_sequencing\Primer Order Form Kurt
2-11-13.xls"
Product Slip
"C:\kurt\storage\CIM Research Folder\DR\2013\2-14-13\sequencing
primers\Sequencing primers for pSMARTIFD.pdf"