Human SMC1a sequence information 01-03-2014d0917

2015-01-13

Human SMC1a sequence information 01-03-2014d0917

Raw Human SMC1a RNA
"C:\Users\kurtw_000\Documents\kurt\storage\CIM Research Folder\DR\2013\6-14-13\SMC1fs\raw sequences\Human SMC1 mRNA.txt"

annotated human smc1a wt sequence (open with ape)


Raw Human SMC1afs RNA
"C:\Users\kurtw_000\Documents\kurt\storage\CIM Research Folder\DR\2013\6-14-13\SMC1fs\raw sequences\human smc1 FS mRNA.txt"

annotated human sm1afs sequence (open with ape)


mRNA sequence of human smc1afs from start codon to stop codon
atggggttcctgaaactgattgagattgagaactttaagtcgtacaagggtcgacagattatcggaccatttcagaggttcaccgccatcattggacccaatggctctgggtgctgtggaatctattgccatgaagaaccccaaagagaggacagctctatttga

nucleotide sequence of 20 bp before and 41 bp after the fusion site of exon 1 to exon 4
cattggacccaatggctctgggtgctgtggaatctattgccatgaagaaccccaaagagag

Protein sequence of human smc1afs from start codon to stop codon
TAIIGPNGSGCCGIYCHEEPQREDSSI