Add PolyT near Lac Promoter 9-18-12

2014-08-29

azim58 - Add PolyT near Lac Promoter 9-18-12


9-18-12

Plan to add poly T near Lac promoter with new primers (the old primers
were incorrect). This time I will use a high fidelity polymerase such as
Advantage 2 rather than Primestar to avoid many non-specific bands. I
will simultaneously perform the reactions with the RPTFC as well as the
RPTFCB primers.

Updated Oligos for adding polyT
APT (for add polyT)
GCTGGTTTCGCTACCGTGGCCCTTTTTTTTTTTTGGCCCAGGCGGCCGAGCTCGCCATG
RPTFC (for reverse polyT fragment corrected)
AAAAAAAAAGCGGCCGCCTAGTAGAACCGTAG
APT2 (for add polyT 2 which corrects any mistakes with the 1st long
primer APT)
GTTTCGCTACCGGGCCCTTT
RPTFC2
AAAAAAAAAGCGGCCGCAGAACC
SAPTFC (for sequence add polyT forward corrected)
AGCGCCCAATACGCAAACCG
SAPTRC (for sequence add polyT reverse corrected)
TGTGGAATTGTGAGCGGATAACAATTTC

I also have two backup primers in case these ones do not work.
RPTFCB (for reverse poly T fragment corrected backup)
GCTAAAAAAAAAAAAAGCGGCCGCCTAGTAGAACCGTAG
RPTFC2B (for reverse poly T fragment corrected 2 backup)
GCTAAAAAAAAAAAAAGCGGCCGCAGAACC

To use these primers, I need to cut the plasmid that has already been
modified with SfiI and NotI (MN 7-21-12 (MN is for modified NotI)). The
fragment needs to be amplified with APT and RPTFC primers (I will use the
Advantage 2 polymerase this time). Then the fragment will be gel
extracted. Then I need to reamplify with APT2 and RPTFC2 primers. Then I
need to perform the In-Fusion reaction with the plasmid backbone. This
plasmid will need to be transformed into some bacteria. Then this plasmid
will need to be sequenced with SAPTFC and SAPTRC. I might also want to
sequence with SANotI and SRNotI.

The 1st step is to cut MN 7-21-12 with SfiI and NotI, and then gel
extract.

Approximate size of expected fragment is about 1.6 kb
Plasmid is about 5 kb
Plasmid backbone is about 3.4 kb

There is an already cut and gel extract fragment that I had from before
(pComb fragment 7-6-12 gel extracted), but I think I will just cut again.

Cut plasmid again. Performed PCR with APT and RPTFC as well as APT and
RPTFCB primers

Item: fragment pComb 9-18-12 KW gel extracted at 10-3-11 -20 C
Item: backbone pComb 9-18-12 KW gel extracted at 10-3-11 -20 C

Gel extracted PCR product. Performed another PCR with APT and RPTFC2 as
well as APT and RPTFC2B primers.

Item: 1 PCR fragment 9-20-12 KW gel extracted at 10-3-11 -20 C
Item: 2 PCR fragment 9-20-12 KW gel extracted at 10-3-11 -20 C

Gel extracted. Performed In-Fusion reaction. Ethanol precipitated.
Electroporated.

9-22-12 Started overnight cultures from single colonies
9-23-12 Performed miniprep to extract plasmids, and sent for sequencing
Item: 1 mpComb 9-22-12 KW at 9-23-12 KW -20 C (the 1 refers to the 1st
electroporation)
Item: 1.2 mpComb 9-22-12 KW 9-23-12 KW -20 C (the 1.2 refers to the 2nd
electroporation. Ethanol precipitated pellet was redissolved better and
another electroporation was performed)
Item: 2 mpComb 9-22-12 KW 9-23-12 KW -20 C (the 2 refers to product that
came from fragment amplified with the "backup" corrected primers (e.g.
SAPTFCB and SAPTRCB))

received sequences
https://mail.google.com/mail/u/0/?ui=2&shva=1#label/Career/13a0ddbeb765
41a3

stored sequences here
C:\kurt\storage\CIM Research Folder\DR\2012\10-2-12\pcomb\sequence

None of the sequences have any reliable information.

Rather than continuing to try to add the poly T near the Lac promoter,
Kathy and I have decided that I should just ligate the scFv into the
plasmid that I have.