Home News Feed

search engine by freefind	advanced

Verify ligation of rcomptt frag 10-26-12

2015-01-13

azim58 - Verify ligation of rcomptt frag 10-26-12 Verify ligation of rcomptt frag 10-26-12 Chose primers "C:\kurt\storage\CIM Research Folder\DR\2012\10-26-12\rcompTT ver\pcomb primer pick 10-26-12.SPF" forward primer SAPTFC AGCGCCCAATACGCAAACCG reverse primer SRNotI CGATTTCGGCCTATTGGTTA see Numbers associated with pcomb rcomp ligation 10-26-1210 If the rcomp fragment is not present then the pcr product should be 284+1677+732 = 2693 If the rcomp fragment is present then the pcr product should be 284+1300+732 = 2316
azim58wiki:

About