Home
News
Feed
search engine
by
freefind
advanced
Tumor Validation primers 1-28-13
2015-01-13
azim58 - Tumor Validation primers 1-28-13 What do these primers bind to? They bind to the beginning and end (or near beginning and near end) of the associated transcript from the first exon to the last exon. An example of an alignment of one of the sets of the primers is found here: "C:\kurt\storage\CIM Research Folder\DR\2013\3-18-13\tumor sequence validation\Rnf130 primer alignment.SPF" see "F:\kurt\storage\CIM Research Folder\DR\2013\1-7-13\validation of cDNA clones\Table of primers 1-7-13.xlsx" for the table of primers see "F:\kurt\storage\CIM Research Folder\DR\2013\1-11-13\primers\Kurt Primer Order Form 1-11-13.xls" for the primer order form also pasted here see also PCR conditions that worked well for amplifying some chimeric transcripts 7-2-13 Note that the F and R at the beginning refer to forward and reverse. The Tr at the end refers to truncated. Note that the reverse side of the primer binds to the 3' end of the gene near the poly A region. =========================================================================== RS61 TTTTTTAAAGCAATTCCAAAGTTTATTAGCCATAG RS61Tr ATGACAGATGGATGTAGCCCAATC FS61 AGAGCCTGTATCTACGAGAGTTC RW17 TTTTTGAATGCTAAGGGTAGTTTATTTTG RW17Tr GACATATTAGGGCATTGTCACCAC FW17 aaattatttcatGAGTTCAGCCGAG FW17Tr GAGCCAACATGAAGACAGCCAC RCX3 TTTTTAAAGGAATATAAAACTATTTATTGACCAC RCX3N CTGGCTCATTGAACCATAACCC RCX3Tr CAACGTCAGCTCCAGCCACG FCX3 GGGCGGTGCTCCCCCTC FCX3N cggcggagctgcccg FCX3Tr CTGGACCGTCGTGTAGTG RRS8 TTTTTCAGATAGAACAGCAGACACC RRS8Tr CTACACATGAGGCTCATTTGCC FRS8 gaaggcggggctgagttttag FRS8Tr CATCTCTCGGGACAACTGGC REA TTTTTAAAAAACATTTAGATATTTCTCTAAGTCATTTTAATTC REATr GAAATGTAGACACTGCAAGCAGG FEA ggaaaggggcgtggcc FEATr GTCACTACTCAGGAGGAGAC RR130 TTTTTGCTTAGCAACACGGTACTTTTATTTTATT RR130Tr CGCTTGTGTGGCATGATTGG RR130WT TTTTTATTTTATTATTTATTTATTTTAATACAAAGCTTTGGC FR130 gccccgcctctcagcac FR130Tr CTGACTTGCAGCCTGTGGC RH1 TTTTTCATTTTTTAAAACCATTTTTTAATTAGTTGAAAG RH1Tr GAGCATACAGTAACATGTGAGTATG FH1 GCAGTCTGGGCGGAGCTTG FH1Tr CGACTGTTCGGGCGCTAC RM1 TTTTTAATAATGAAATAATTTATTTGTTAATGGACGG RM1Tr GCACCATTCTCCAGTCTCAGCAG FM1 ggcgagtcgggataaacac FM1Tr ATGAACATCCAGCTGCTGCTGG Rco1WT TTTTTCATTGAGAAAGACATATAGGATATGAG Fco1 tatgttcattaatcgttgattattctcaacc Fco1Tr CTACTATTCGGAGCCTGAGCG Rco1 TTTTTACTGAGAAAGACATATAGGATATGAGATTG Rco1Tr CATAGGTTGGTTCCTCGAATG =========================================================================== PCR reactions with these primers RS61+FS61 RS61Tr+FS61 RW17+FW17 RW17Tr+FW17Tr RCX3+FCX3 RCX3N+FCX3N RCX3Tr+FCX3Tr RRS8+FRS8 RRS8Tr+FRS8Tr REA+FEA REATr+FEATr RR130+FR130 RR130Tr+FR130Tr RR130WT+FR130 RH1+FH1 RH1Tr+FH1Tr RM1+FM1 RM1Tr+FM1Tr Rco1WT+Fco1 Rco1+Fco1 Fco1Tr+Rco1Tr =========================================================================== Primer-BLAST Results primer blast results FCX3 p RCX3 "C:\Users\kwhittem\Google Drive\DR\2013\8-15-13\primer blast results FCX3 p RCX3.txt" ----------- These tumor validation primers were received 1-28-13 Technical Datasheet "C:\kurt\storage\CIM Research Folder\DR\2013\1-28-13\primers\Tumor Validation Primers 1-28-13.pdf" Working stock of primers located at 4 C box 1-29-13 KW -3-21-13 these primers were labelled as 10 nM, but I am very confident that they are actually 10 uM so I changed the labels on the tubes. 100 uM aliquots of RS8 and EATr primers located at 7-2-13 -20 C box 100 uM aliquots of some primers 9-10-13 (wikipad) ------------- see also Nested primers for Cbx3 8-15-13 "F:\kurt\storage\CIM Research Folder\DR\2013\8-15-13\nested primers for Cbx3 8-15-13.txt"
azim58wiki: