Home
News
Feed
search engine
by
freefind
advanced
TRF1 portal 09-25-2014d1413
2015-04-16
TRF1 portal 09-25-2014d1413 Issues to investigate -TRF1 overexpression -TRF1 deletion -also look at TRF2 -[cni_TRF1 and TRF1 lox dna sequence details 04-12-2015d1006] Mice with decreased TRF1 expression live longer, and they don't know why. How much longer do they live? No expression seems to be very bad. Good paper to look at -[TRF1 is a stem cell marker and is essential for the generation of induced pluripotent stem cells] --recommended by Marinela Some highlights -A component of the shelterin complex -Deficiency leads to embryonic lethality -Deficiency leads to atrophy when deleted in adults -Deficiency can impair tumor growth -Highly expressed in stem cell compartments -Highly expressed in iPSCs and also necessary for reprogramming -TRF1 overexpression negatively regulates telomere length --[cni_contradiction about TRF1 telomere length negative regulation and reprogramming 01-26-2015d1737] TRF1 papers -[Conditional TRF1 knockout in the hematopoietic compartment leads to bone marrow failure and recapitulates clinical features of Dyskeratosis congenita] -[Increased telomere fragility and fusions resulting from TRF1 deficiency lead to degenerative pathologies and increased cancer in mice] -[TRF1 controls telomere length and mitotic fidelity in epithelial homeostasis] TRF1 review papers { TRF1, a mammalian telomeric protein 1997 Telomere structure and telomerase in health and disease (Review) 2012 Telomerase and telomere-associated proteins: structural insights into mechanism and evolution. 2012 Shelterin complex and associated factors at human telomeres. 2011 Inside the mammalian telomere interactome: regulation and regulatory activities of telomeres. 2006;16(2):103-18. Review Shelterin: the protein complex that shapes and safeguards human telomeres. de Lange Regulation of telomerase by telomeric proteins. Telomeres in cancer and ageing. Blasco 2011 paper } RefSeq Mouse Terf1 TRF1 RNA NM_001286628.1 http://www.ncbi.nlm.nih.gov/nuccore/NM_001286628 Primers for TRF1 RNA RflExonControl_Fw GTCTCTGTGCCGAGCCTTC TRF1 Schneider, 2013 110bp mouse (I don't understand where I got the name RflExonControl for these primers. In Ralph's paper they have the name mTRF1. I may have been confused.) RflxExonControl_Rv TCAATTGGTAAGCTGTAAGTCTGTG TRF1 mouse TRF1BF TCTAAGGATAGGCCAGATGCCA TRF1 Muñoz, 185 bp mouse TRF1BR CTGAAATCTGATGGAGCACGT TRF1 mouse eGFP—TRF1—F CCTGAGCAAAGACCCCAAC eGFP—TRF1—R TCCTCCTGCTCTGGAGAATC -[cni_TRF1 primers of Agueda 03-29-2015d1129] -[cni_Antibody for detecting TRF1-eGFP 03-12-2015d1032] Some questions What is the size of TRF1-eGFP protein? -molecular weight is about 50 kD --see Figure 7C of western blot in Ralph Schneider's Thesis
azim58wiki: