Some finished to do list items 2012

2015-01-13

azim58 - Some finished to do list items 2012

* When I do flow cytometry again, ask Penny about appropriate voltages
  and how to centrifuge and resuspend cells

When I finish doing ELISISPOT/T cell assay testing, return CPV172
  pooled peptide to Shen.

Things to do during Christmas break
  read the other dissertations (read Hojoon's dissertation first)
  make notes about committee meeting
  organize and write dissertation
  work on mouse tumor cDNA library paper?
* 
  fix table 2 of paper
  attend to robosep e-mail
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Career/13b42e7922
  bc8194
  get more human RNA?
  make sure I am on track for graduation
  look at graduation details
* take BDGP survey
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/13ba476b464d1fd3
* attend to e-mails
* Things to do before committee meeting
  look at SMC hits
  make actual presentation
  look over summary document
  look over breast cancer grant document
  look at other tumor library sequences
  meet with Kathy
  I'm curious exactly which pools the single clones came from
* 
  look at SEREX publication from Kathy
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#search/compare+and+cont
  rast/13b4ce19a56fdfcc
* redeem chase money
* do workplace behavior training
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Career/13ab9238a5
  51fa00
* Plan stem cell experiment
* attend to smcfs paper
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Career/13b013bf62
  19ea9e
* electroporation with stellar
* order DpnI?
  look at travel stuff (e.g. follow up with graduate college travel
  grant?)
* sequence MN pComb
  pJet cloning? (I'm not so sure this is necessary)
* analyze scanned slide data
* send Kathy e-mail about ova ctl assay
* take care of drivers license issue
* take a look at the data to see if there is an improvement with
  reduction to single clone/component.
* look at Mara's midterm paper
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Career/13a4b70fd0
  1fdab0
* 
  register to vote
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Miscellaneous/13a
  2eaa092393f2a
* update ARCS profile
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#label/Career/139e2b275e
  293817
* store this info somewhere
  Automatic DNA microarray gridding based on Support Vector Machines
  http://www.researchgate.net/publication/224355444_Automatic_DNA_microarra
  y_gridding_based_on_Support_Vector_Machines
  Unsupervised SVM-based gridding for DNA microarray images.
  http://www.researchgate.net/publication/38057390_Unsupervised_SVM-based_g
  ridding_for_DNA_microarray_images
* check out Diana's artwork
  www.midnightclashtiger.deviantart.com
* discuss iPOS with Maria
* Analysis Shen is interested in
* look at Zbig's Tecan run (see Tumor vs normal on Single Clones 9-12-12
* look at papers from Kathy (see 1-5-12 e-mail)
* analyze 16E3 sequences
* redo dot blot (do naive at 10e6 fold dilution, do replicates of
  spots, have a membrane for naive, tumor, secondary, and no antibody)
* revise pcomb primer issue

talk to Andrey about poly T in-fusion stop codon issue
* look at A5 spot
* look at tumor intensity distribution
* Mara and I need to look into stop codon issue in 5' cap region
* make mimotope paper revisions
* make record of peptide bead conjugation
* make supplementary heatmap
* revise Shen's paper:
  L:\storage\Documents\Career\Biodesign Institute\Miscellaneous\Paper
  Proofreading for Others\Shen's Dissertation\Chapter 3 of Shen's
  thesis\My revisions
  check introduction too
* ask Andrey questions
  Is it okay to have a primer start with many As or Ts? I have a GC clamp
  at the end. Here are the primers I want to use.
  RPTFC: AAAAAAAAAGCGGCCGCCTAGTAGAACCGTAG
  RPTFC2: AAAAAAAAAGCGGCCGCAGAACC
* revise CTL protocol
* note about quickly renaming files
* paper author info
* order clontech kit
* look at raw data of single lysate experiment for increases

look at clontech 5' end issue
* check Shen's abstract too
* look at entropy of qc samples
  http://www.azim58.wikispaces.net/Entropy+Analysis+of+QC+Samples+7-20-12
* do
  surveymonkey.com/s/TNCCCXY
* look at purified sera array data
* 
  Look at Shen's changes to SMC1fs paper (I think this is all done)
  https://mail.google.com/mail/u/0/?shva=1#inbox/1373c21d52f8d86d
  o switch axis labels in cross-reactivity figure
    discuss how many peptides have with motif are in 108 peptide list

make Kathy's changes to paper
* adjust heatmaps so that they are red to green
* adjust cross-reactivity figure so that it is a 3D graph
* perform bone marrow surgery
* look at nci tissue bank info
* look at current protocols in immunology 9.3
* possibly plan ova immunization
* look at optimal laser powers and gains
  choosing laser power and gain
* look at fastbleep reply
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/135ac1b7d2f9317e
* read about insert to vector ratios with ligation
* Java code to put tab delimited text into some object
* look at current protocols in immunology 9.3
* look at fastbleep e-mail
  https://mail.google.com/mail/u/0/?shva=1#inbox/135ac1b7d2f9317e
* look at correlation of tumor on two library array experiments
* work on SMC1fs paper
  see Shen's e-mail from 3-27-12
* make heatmap figure for Shen with 4 peptides and all clinical samples
  o respond to Phils e-mail about this
    - https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/1371892
      6742bf690

* make context independent sequence annotator
* think about writing article for fastbleep (just do an e-mail search)
* check how often PQRE occurs in all peptides on array
* Kathy's recent e-mail
  https://mail.google.com/mail/u/0/?shva=1#inbox/136a6e76e738a61d
  Japan conference
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/136db7842e8b1b02
* find relative abundance of transcripts
  o GEO can help me find the relative abundance of transcripts
    look at the microarray mRNA data for my particular cell line: 4T1
  o Note that Danielle did a lot of this already

* see whether Rose and Maher scholarship is appropriate for me
  3-27-12 e-mail from Stephen
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/13656cfe6e26cb3b
* Also address TopCount decision
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/136418fddd09ccb9
* ARCS Tasks 2012-2013
  ARCS dinner (April 27th)
  Committee Meeting (Thursday April 26th)
* After I am caught up with safety courses, then regain access to both
  3rd floor parts and Lebaer's lab
* take fire safety course (12/29/2010 FIRE FIRE SAFETY/PREVENTION 12
  months FIRE)
  see 3-26-12 e-mail from John Phillips
* and biosafety and bloodborne pathogen training
  enrollment accepted from Christine Carlson on May 26th
* write public outreach summary
* read Xiao's proposal if there is time
  https://mail.google.com/mail/u/0/?ui=2&amp;shva=1#inbox/1369dfe28bcd50af
* make spreadsheet out of Planning 1-26-12 page
* prepare more pmsf and dnase I
* 
  analyze colony hyb pictures
  "S:\Research\Cancer_Eradication\Users\kwhittem\kwhittem\Raw Data Often
  Originally on Research Drive\2012\colony hyb 4-3-12"
  I also have some images from March 24th
finish entering immunofluorescence protocol
organize Bart's confocal images
"S:\Research\Cancer_Eradication\Users\kwhittem\kwhittem\Raw Data Often
Originally on Research Drive\2012\4-3-12 confocol images"
mailed letter to ARCS donors
write letter to ARCS donors
enter ELISPOT protocol
analyze ELISPOT data
When 2 P50 Biomek tips come in, make sure these are saved for Zbig
analyze SMC1fs data
look at lab manual of Barbas (see 1-5-12 e-mail)
get T cell and phage book
follow up with Topcount and see David Lent's feb 29th e-mail
determine concentration of glycerol stock
make slide-a-lyzer page
perform ELISPOT on T cells from last mouse in old ova group
analyze SMC1fs arrays
analyze decanting results: Test of Decanting after fluor is added 2-3-12
order electrocompetent cells
order 96 well round bottom plates (
http://azim58.wikispaces.com/96+well+round+bottom+plate)
find out amount of reagent used with t cell enrichment kit
If/When cold room is cleared out

* move Robosep back to room temperature
read cheek bleed protocol
update protocols learned from Bart
research more info about phage (Dec 1st e-mail from Clontech)
read some of PhD Phage Display Cloning Kit
order SAS
analyze ctl data
analyze array data
Renew Phi Kappa Phi Membership
Check to make sure Sfi site on scFv is compatible with PCANTAB site
34 of 39 on SMART cDNA library kit
Hazardous waste management refresher (Nov 17th e-mail)
Order ELISA plates
edit ARCS application
ask robosep about 4 C
buy more antibodies and dyes
ARCS!
Summary of TED event for JoAnne
monoclonal antibody paper from Stephen (10-30-11)

Deal with Robosep software upgrade (Julia October 21st e-mail)

Find restriction sites outside of SfiI and NotI in PCANTAB
Mark has a a plasmid that can be cut with EcoRI and HindII: pET23a with
gp160

* These sites can't be used to cut my PCANTAB for some reason.

azim58wiki: