Home
News
Feed
search engine
by
freefind
advanced
PCANTAB5E Plasmid
2015-01-13
azim58 - PCANTAB5E Plasmid Length: 4472 bp Origins: f1, pBR322 (pMB1 ori) The origin of replication or ori site in this plasmid (pBR322) is pMB1 (a close relative of ColE1) http://en.wikipedia.org/wiki/PBR322 These are both low copy origins of replication. Antibiotic Resistance: ampicillin Information about plasmid: -The phagemid vector pCANTAB 5 E is widely used for the selection of antibody fragments from corresponding libraries. http://www.ncbi.nlm.nih.gov/pubmed/11849927 -PCANTAB5E is a phagemid plasmid - McCafferty et al. described in 1990 the fd-CATI original phage vector forantibody display (27). These vectors contain all the genetic information encoding the phage life cycle, in this context, an alternative system has been used upto now. This system involves cloning into phagemid vectors that contain acopy of the gene 3 and phage packaging signal sequence. Thus, antibody fragments can be displayed as a fusion with the gene 3 protein and the genetic infonnation is packaged thanks to the packaging signal. In our laboratory we have used the phagemid vector pCANTAB 5 E included in the Pharmacia RPAS kit. This vector allows cloning of antibody genes into Sfi I and Not Isites. This vector incorporates an amber codon between the C-terminus of the cloned scFv and (he start of gene 3 sequence aIIowin the recombinant antibody to be made as a soluble protein. This vector also includes a peptide tag,allowing the detection of the single-chain antibody. http://books.google.com/books?id=h0lx0ACckP8C&pg=PA137&lpg=PA137&am p;dq=what+is+the+pcantab+plasmid+used+for&source=bl&ots=t2mBV2oY07& amp;sig=TImrbx0PEgQe3P2JnwCBJidXhYg&hl=en&ei=HY9STq6wAszisQL2tojYBg &sa=X&oi=book_result&ct=result&resnum=1&sqi=2&ved=0 CB4Q6AEwAA#v=onepage&q&f=false * ORF1: o (2218,3594) o Length: 1376 o Description: This ORF basically seems to code for the p3 protein of M13 phage. When an scFv fragment is inserted between the SfiI and NotI sites, a recombinant p3 scFv protein is produced. o Most Similar Blast result: - Type 3 trypsin release phage display vector f3TR1, complete sequence - http://www.ncbi.nlm.nih.gov/nucleotide/307776653?report=genbank &log$=nucltop&blast_rank=1&RID=554H7MGA01N - The displayed peptide is connected to the bulk of pIII through a trypsin-sensitive tether. o Sequence: - PCANTAB5E ORF1 Sequence (pIII protein) o M13F at 3620 - actggccgtcgttttac o M13R at 2208 - ggaaacagctatgaccatg Miscellaneous Info: M13 F sequence: 5'-GTCACGACGTTGTAAAACGACGGCCAGTCTGACTTTGGCAGCCCTT-3' M13_R sequence: 5' CAGGAAACAGCTATGACCATG 3' NotI_F sequence (goes over border of plasmid and insert): 5' CTGCGGCCGCCCGTTT 3' If I want to check whether a plasmid has an insert, I should use the NotI primer and the M13_R primer (located in Tien's scFv phage 3 box). Now it would actually be better to check for an insert using the same primers that were used to construct the scFv. * To check a kappa insert, use these primers o MHV_Back_SfiI + MKV_For_NotI * To checka lambda insert, use these primers o MHV_Back_SfiI + MLV_For_NotI * see Primers to check for scFv NotI: 2368-2375 gcggccgc SfiI: 2316-2328 ggcccagccggcc ggcc[nnnnn]ggcc fragment between NotI and SfiI: (2368-2328)= 40 bp Sequence: PCANTAB5E Sequence Source of Sequence: https://www.lablife.org/ll?a=showvecinfo&vectorid=5225 Questions: ScFv inserted into the PCANTAB5E vector will eventually result in recombinant p3 scFv proteins. However, won't 2/3 of the inserted scFv cause a frameshift resulting in a faulty p3 protein? Perhaps the last part of the p3 protein is not critical for forming a functional M13 phage.
azim58wiki: