Home
News
Feed
search engine
by
freefind
advanced
Compatibility of PCANTAB5E and M13cp-CT
2015-01-13
azim58 - Compatibility of PCANTAB5E and M13cp-CT see Two Plasmids One E coli for more information Compatibility of My Origins of Replication PCANTAB5E: F1 origin of replication M13cp-CT: based on M13mp19 plasmid which has the F1 origin of replication -If both plasmids truly do have the F1 origin of replication, then they are not compatible. -I suppose I could order primers and use PCR to check for sure. -If it does have the F1 origin of replication, I would need to replace it with a different origin of replication somehow. Compatibility table: http://www.bio.davidson.edu/Courses/Molbio/Protocols/ORIs.html >F1 Sequence gcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcct ttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctcccttta gggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggcca tcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaact ggaacaa Length: 309 To check if my M13cp-CT and M13cp plasmids really do have this sequence I will need to do a colony PCR. The Primer3 website recommends these primers Primer_1_F F1_F ctcctttcgctttcttccct Start: 70 Length: 20 Tm: 59.955 GC%: 50.000 ANY: 2.00 SELF: 2.00 Primer_1_R F1_R aagggcgaaaaaccgtctat Start: 253 Length: 20 Tm: 59.966 GC%: 45.000 ANY: 3.00 SELF: 3.00 Product Size: 183 Pair Any: 6.00 Pair End: 1.00 Link to order form for these primers: http://www.wuala.com/azim58/wuala/CIM%20Research%20Folder/kwhittem/Records% 20in%20CIM%20Folder/Dated%20Records/2011/5-11-11/F1%20Ori%20Primers.xls/ Link to receipt for these primers: http://www.wuala.com/azim58/wuala/CIM%20Research%20Folder/kwhittem/Records% 20in%20CIM%20Folder/Dated%20Records/2011/5-23-11/F1%20ori%20primer%20Receip t.pdf/
azim58wiki: