CloneJet PCR Cloning Kit

2015-01-13

product from ThermoScientific

original manual can be found here
http://www.thermoscientificbio.com/uploadedFiles/Resources/k1230-product-information.pdf

pJET1.2 sequence
here
"F:\kurt\storage\CIM Research Folder\DR\2013\9-3-13\pJET 9-3-13.SPF"
"F:\kurt\storage\CIM Research Folder\DR\2013\6-20-13\pJet1.2 sequence.txt"
and here (left flank before blunt end pcr product at end)
"F:\kurt\storage\CIM Research Folder\DR\2013\6-20-13\pJet1.2 sequence with left flank at end.txt"
http://www.thermoscientificbio.com/uploadedFiles/Resources/k1230-product-information.pdf

>left flank pjet sequence before blunt-end pcr product
GGCGTAATACGACTCACTATAGGGAGAGCGGCCGCCAGATCTTCCGGATGGCTCGAGTTTTTCAGCAAGAT
>right flank pjet sequence after blunt-end pcr product
ATCTTTCTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCT

pJET primer location

pJET1.2 forward sequencing primer, 23-mer
5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
OligoMaster Tm: 60.5

pJET1.2 reverse sequencing primer, 24-mer
5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
OligoMaster Tm: 53.9
reverse complement of reverse sequencing primer:
CTGCCATGGAAAATCGATGTTCTT
^If these sequencing primers are used for PCR, then 62+57=119 bp will be added to the fragment within the vector.

Blunt-End Cloning Protocol
Note that most polymerases create blunt ended products (Andrey says that more than 90% of all polymerases would do this)
• For cloning blunt-end PCR products generated by proofreading DNA polymerases, such as Pfu DNA polymerase. (If the DNA end structure of the PCR products is not specified by the supplier of the DNA polymerase, follow the Sticky-End Cloning Protocol on page 6).
• For cloning of blunt-end DNA fragments generated by restriction enzyme digestion. Gel-purify the DNA fragment prior to ligation and use in a 3:1 molar ratio with pJET1.2/blunt (see Table 1).
1. Set up the ligation reaction on ice:

Want 0.15 pmol ends >> what volume of DNA sample do I need?
(0.15*"pmol"*"ends")*(1*"mol"*"ends")/(1e12*"pmol"*"ends")*(6.02e23*"ends")/(1*"mol"*"ends")*(1*"molecule")/(2*"ends")*(# bp *"bp")/(1*"molecule")*(1*"mol"*"bp")/(6.02e23*"bp")*(660*"g")/(1*"mol"*"bp")*(1e9*"ng")/(1*"g")*(1*"uL")/(concentration *"ng") = # "uL" of sample

-Spreadsheet for 0p15 pmol ends 8-23-13
--"F:\kurt\storage\CIM Research Folder\DR\2013\8-23-13\Spreadsheet for 0p15 pmol ends 8-23-13.xlsx"

see volume dna for y pmol ends 6-14-13

Reaction
-2X Reaction Buffer 10 µl
-Non-purified PCR product: 1 uL
or
purified PCR product/other blunt-end DNA fragment: 0.15 pmol ends (volume cannot be > than (20-10-1-1)*"uL"=8*"uL" for the 20 uL rxn)
-pJET1.2/blunt Cloning Vector (50 ng/µl) 1 µl (0.05 pmol ends)
Water, nuclease-free up to 19 µl
T4 DNA Ligase 1 µl
Total volume 20 µl
--Andrey and Felica typically do 1/4 the amount of all of the reagents per reaction
--Andrey thinks that using double the amount of purified product may yield better results

Vortex briefly and centrifuge for 3-5 s.
2. Incubate the ligation mixture at room temperature (22°C) for the incubation time.
-Original protocol recommends incubation time of 5 min. However, Andrey recommends using 20-30 m instead.
Note. For PCR products >3 kb, ligation can be prolonged to 30 min. Ligation times longer than 30 min are not recommended and may decrease cloning efficiency.

Our lab often ethanol precipitates the reaction before proceeding to do a transformation. <- Felicia told me she obtained many more colonies when she did not do an ethanol precipitation first.
3. Use the ligation mixture directly for transformation (see page 7 for Transformation) (for a chemical transformation <= 5 uL ligation mixture is recommended for 50 uL cells)
(for electrotransformation 1 uL of purified ligation mixture is recommended for 40 uL cells)
Note. Keep the ligation mixture at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation.

CONTROL CLONING EXPERIMENT
The control reaction should be used to verify the efficiency of the blunting and ligation steps. The 976 bp control PCR product (nucleotide sequence is available at www.thermoscientific.com/onebio) has been generated with Taq DNA polymerase, which adds extra nucleotides to the 3'-end. Therefore, the Sticky-End Protocol must be followed.
1. Set up the blunting reaction on ice:
Component
Volume
2X Reaction Buffer
10 µl
Control PCR Product (24 ng/µl)
2 µl
Water, nuclease-free
5 µl
DNA Blunting Enzyme
1 µl
Total volume
18 µl
Vortex briefly and centrifuge for 3-5 s to collect drops.
2. Incubate the mixture at 70°C for 5 min. Chill on ice.
3. Set up the ligation reaction on ice. Add the following to the blunting reaction mixture:
Component
Volume
pJET1.2/blunt Cloning Vector (50 ng/µl)
1 µl
T4 DNA Ligase
1 µl
Total volume
20 µl
Vortex briefly and centrifuge for 3-5 s to collect drops.
4. Incubate the ligation mixture at room temperature (22°C) for 5 min.
5. Use the ligation mixture directly for transformation (see page 7 for Transformation). Keep the ligation mixture at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation.
Analyze colonies by colony PCR (see page 8). At least 9 of 10 analyzed colonies should contain recombinant plasmid with the 976 bp insert.
The number of transformants depends on the transformation efficiency of the E. coli cells. Verify the transformation efficiency by transforming supercoiled plasmid, e.g., pUC19 DNA (#SD0061) in parallel. Refer to page 7 Table 2 for correct control transformations.

azim58wiki: