1-23-13 Sequencing results

2014-08-29

azim58 - 1-23-13 Sequencing results

1-23-13 Sequencing Results

Received sequencing results after I attempted to linearize the pcomb
plasmid and perform an in-fusion with a pca constructed fragment. The
purpose of this was to try to readd the stop codon that had been deleted
during previous modifications (see 11-5-12 Correct deletion of stop codon)

Sequencing results found here
"C:\kurt\storage\CIM Research Folder\DR\2013\1-23-13\pcomb fusion
sequencing check 1-23-13"

Three colonies were sent for sequencing from each group. The groups were
as follows.

1 previous ethanol precipitated vector in-fusion bottom band (gel of
bands on 1-14-13 of notebook)
2 previous ethanol precipitated vector in-fusion middle band (gel of
bands on 1-14-13 of notebook)
3 previous ethanol precipitated vector in-fusion top band (gel of bands
on 1-14-13 of notebook)
4 vector in-fusion bottom band (gel of bands on 1-16-13 of notebook)
5 vector in-fusion middle band (gel of bands on 1-16-13 of notebook)
6 vector in-fusion top band (gel of bands on 1-16-13 of notebook)

Which plasmids had the correct sequencing result?
1p1 (this sequence does not seem to be quite right; it has 1 bp deleted
at 2628 of what pcomb3xssv3 should be)
1p2
1p3
4p1
4p2
4p3
5p1
6p2

region of interest
TTAATTTAAGGCCGCAGATCTGGGAAATTGTAAGCGTTAATATTTTG

As soon as I receive the Primers to sequence whole pcomb3XSSv3 then I can
choose a few of these plasmids to verify the whole sequence.

===========================================================================
2-7-13

Sequencing results for whole plasmid
C:\kurt\storage\CIM Research Folder\DR\2013\2-7-13\pcomb_sequences

Original Sequencing files
"C:\kurt\storage\CIM Research
Folder\DR\2013\2-7-13\pcomb_sequences\original sequencing files"

2-12-13
I handed this off to Mara and she started working on it.
Her files can be found here
S:\Research\Cancer_Eradication\Discovering tumor specific antigens\Phage
Library\2-12-13 pcomb sequences

azim58wiki: